Κυριακή, 4 Σεπτεμβρίου 2016

ΑΡΓΥΡΟΠΕΛΕΚΑΝΟΣ ΣΤΟΝ ΑΜΒΡΑΚΙΚΟ ΚΟΛΠΟ
















ΑΜΒΡΑΚΙΚΟΣ ΚΟΛΠΟΣ -ΚΟΡΩΝΗΣΙΑ- ΑΡΤΑ
GREECE

ΑΣΚΗΣΗ ΜΕ ΩΡΙΜΑΝΣΗ




Το λειτουργικό πεπτίδιο ενός ευκαρυωτικού κυττάρου αποτελείται από 145 αμινοξέα και καθίσταται λειτουργικό μετά από απομάκρυνση 5 αμινοξέων από το αρχικό αμινικό άκρο του .Η 5΄αμετάφραστη περιοχή του ώριμου mRNA έχει μήκος 20 ριβονουκλεοτίδια , ενώ η 3΄αμετάφραστη περιοχή του έχει μήκος 27 ριβονουκλεοτίδια .Τα εξώνια του ασυνεχούς γονιδίου ,που κωδικοποιεί το παραπάνω πεπτίδιο , αποτελούν το 25% του μήκους του γονιδίου αυτού .Να βρεθούν και να αιτιολογηθούν :
α) το μήκος του ώριμου mRNA
β) το μήκος όλων των εσωνίων
γ) το μήκος του γονιδίου
δ) αν τα εξώνια στο γονίδιο είναι πέντε , να υπολογίσετε τους δεσμούς που θα σπάσουν και θα δημιουργηθούν κατά την διαδικασία της ωρίμανσης που συμβάλλει στην παραγωγή του πεπτιδίου αυτού .
ε) σε ποιο μέρος του κυττάρου λαμβάνει χώρα η διαδικασία της ωρίμανσης και ποια ένζυμα την επιτελούν;

Σάββατο, 3 Σεπτεμβρίου 2016


ΑΣΚΗΣΗ ΜΕ ΘΗΛΙΑ ΑΝΤΙΓΡΑΦΗΣ

 Το σχήμα δείχνει τη  μοναδική θηλιά αντιγραφής ενός μορίου DNA ευκαρυωτικού κυττάρου . Αν τα πρωταρχικά τμήματα των κλώνων   που αντιγράφονται συνεχώς έχουν μήκος 8 αζωτούχες βάσεις και στη θηλιά υπάρχουν συνολικά 10 πρωταρχικά τμήματα στους ασυνεχείς κλώνους , να βρεθούν :
α) η αλληλουχία βάσεων και ο προσανατολισμός των πρωταρχικών τμημάτων , των συνεχών κλώνων .
β) ο αριθμός των πρωταρχικών τμημάτων που υπάρχουν στην κάθε διχάλα αντιγραφής .
γ) οι δεσμοί υδρογόνου που πρέπει να σπάσουν για την αντικατάσταση των πρωταρχικών τμημάτων , των κλώνων που αντιγράφονται συνεχώς .
δ) Τι προέλευσης είναι το DNA αυτό και ποιο είναι το σχήμα του ;
ε) Δικαιολογείστε αναλυτικά τις παραπάνω ερωτήσεις . 



Παρασκευή, 2 Σεπτεμβρίου 2016


ΑΣΚΗΣΗ ΜΕ ΜΕΤΑΓΡΑΦΗ




  ΑΛΥΣΊΔΑ  1 ........................................................................................
  ΑΛΥΣΙΔΑ  2 ........................................................................................ΟΗ-
      mRNA      AUUUAUGAAUCAGCUGAUUUACGUAUGAGCC

Το παραπάνω σχήμα απεικονίζει το υβρίδιο mRNADNA  που δημιουργείται κατά τη διαδικασία της μεταγραφής ενός βακτηριακού γονιδίου .Να βρεθούν :
α) οι προσανατολισμοί των αλυσίδων του DNA και του mRNA
β) Σε ποια θέση βρίσκεται ο υποκινητής του γονιδίου αυτού ;
γ) Πόσοι δεσμοί θα δημιουργηθούν και πόσοι θα διασπαστούν κατά τη δημιουργία της μεταγραφής αυτής ;
δ) Με τη χρήση του γενετικού κώδικα να βρεθεί το πεπτίδιο που θα παραχθεί και να σημειωθεί ο προσανατολισμός του .
ε) Όταν το tRNA που κουβάλησε το τρίτο αμινοξύ αποδεσμευτεί , ποιο θα είναι το αντικωδικόνιο του tRNA που θα προσέλθει ;

ΑΡΧΑΙΑ ΚΑΣΣΩΠΗ













αριστερα ο Αμβρακικός κόλπος και δεξιά το Ιόνιο πέλαγος

ΑΡΧΑΙΑ ΚΑΣΣΩΠΗ -ΠΡΕΒΕΖΑ-GREECE

ΑΣΚΗΣΗ ΜΕ ΠΟΛΥΣΩΜΑ



Οι 5΄και 3΄αμετάφραστες περιοχές ενός mRNA προκαρυωτικού κυττάρου έχουν συνολικό μήκος 55 αζωτούχες βάσεις και αποτελούν το 1/10 του μήκους του mRNA αυτού . Αν η απόσταση ανάμεσα σε δύο διαδοχικά ριβοσώματα του πολυσώματος που σχηματίζεται είναι 90 ριβονουκλεοτίδια και το τελευταίο στη σειρά ριβόσωμα βρίσκεται στο κωδικόνιο έναρξης , να υπολογιστούν :
α) ο αριθμός των ριβοσωμάτων του πολυσώματος αυτού
β) το μήκος του πεπτιδίου που παράγεται από το πολύσωμα αυτό
γ) πόσα ακόμα αμινοξέα θα πρέπει να προστεθούν στο πεπτίδιο του πρώτου ριβοσώματος για την ολοκλήρωση της σύνθεσής του ;
δ) Πως επιτυγχάνεται η γονιδιακή ρύθμιση στο στάδιο αυτό της πρωτεΐνοσύνθεσης ;
ε) Αν τα tRNA βρίσκονται στην πρώτη θέση εισδοχής της μεγάλης υπομονάδας των ριβοσωμάτων του πολυσώματος αυτού , να υπολογίσετε το μήκος των πεπτιδίων σε κάθε ριβόσωμα του πολυσώματος αυτού, για το στιγμιότυπο που αναφέρεται .