Παρασκευή, 28 Οκτωβρίου 2016

ΓΟΝΙΔΙΑΚΗ ΘΕΡΑΠΕΙΑ ΓΙΑ ΤΗΝ ΔΡΕΠΑΝΟΚΥΤΤΑΡΙΚΗ ΑΝΑΙΜΙΑ

ΑΣΚΗΣΗ ΜΕ ΓΟΝΙΔΙΑΚΗ ΘΕΡΑΠΕΙΑ



Άντρας με κυστική ίνωση υπεβλήθει σε in vivo γονιδιακή θεραπεία , με επιτυχή αποτέλεσμα . Ο άντρας αυτός παντρεύτηκε μια φυσιολογική γυναίκα , φορέα όμως του γονιδίου της κυστικής ίνωσης και γέννησαν ένα παιδί που εμφάνισε τα συμπτώματα της ασθένειας .Ο άντρας στα επόμενα χρόνια της ζωής του εμφάνισε καρκίνο του πνεύμονα και θεώρησε τη γονιδιακή θεραπεία που του υπεβλήθει , ως υπεύθυνη για τον καρκίνο που εμφάνισε .
α) Περιγράψτε τη διαδικασία της  θεραπείας που του υπεβλήθηκε . Γιατί ονομάζεται in vivo ;
β) Πως μπορεί να εξηγηθεί  η εμφάνιση καρκίνου του πνεύμονα  στον άντρα αυτόν που θεραπεύθηκε από την κυστική ίνωση με την γονιδιακή θεραπεία ;Η εξήγηση να γίνει με βάση το γενετικό επίπεδο , λαμβάνοντας υπόψη και τον τρόπο με τον οποίο δρα ο ιός φορέας .
γ) Όταν γεννήθηκε το παιδί με την κυστική ίνωση , η γυναίκα θεώρησε ότι η γονιδιακή θεραπεία του συζύγου της δεν ήταν απόλυτα επιτυχής . Είναι βάσιμος ο ισχυρισμός της ;
δ) Ποια είναι η πιθανότητα το ζευγάρι αυτό να γεννήσει ξανά παιδί με κυστική ίνωση ;
ε) Σας καλούν στο δικαστήριο για να υπερασπιστείτε την βιοτεχνολογική εταιρεία που εφάρμοσε τη γονιδιακή θεραπεία , απέναντι στον ισχυρισμό του ασθενούς ,ότι δεν εφάρμοσαν την γονιδιακή θεραπεία στα γενετικά του κύτταρα και γι΄αυτό γεννήθηκε παιδί με κυστική ίνωση .Αναπτύξτε τη  θέση σας σαν βιολόγος .

Pronucleus microinjection

ΧΡΗΣΙΜΟΠΟΙΗΣΗ ΜΙΚΡΟΒΕΛΟΝΑΣ - ΜΙΚΡΟΣΚΟΠΙΟΥ

ΑΣΚΗΣΗ ΜΕ ΔΙΑΓΟΝΙΔΙΑΚΑ ΖΩΑ



Για την παραγωγή μιας φαρμακευτικής πρωτεΐνης από διαγονιδιακή κατσίκα , εφαρμόστηκε η μέθοδος της μικροέγχυσης  , με επιτυχή αποτέλεσμα. Στο διαγονιδιακό ζώο που δημιουργήθηκε , το γονίδιο που κωδικοποιεί τη φαρμακευτική πρωτεΐνη  ανιχνεύτηκε στο ένα από τα δύο χρωμοσώματα του 5ου ζεύγους ομολόγων χρωμοσωμάτων του .Το διαγονιδιακό ζώο αυτό στη συνέχεια το διασταυρώνουμε με άλλο ζώο μη διαγονιδιακό για να μεταβιβαστεί  το γονίδιο της φαρμακευτικής πρωτεΐνης στους απογόνους .
Να απαντήσετε στις παρακάτω ερωτήσεις :
α) Να περιγράψετε τη διαδικασία δημιουργίας του διαγονιδιακού ζώου .
β) Με ποιον άλλο βιοτεχνολογικό τρόπο θα μπορούσαμε να παράγουμε μαζικά την φαρμακευτική πρωτεΐνη ; Να περιγράψετε συνοπτικά τη διαδικασία αυτή .
γ) Πως μπορούμε να διαπιστώσουμε ότι το ζώο που γεννήθηκε είναι διαγονιδιακό ;
δ) Ποια η πιθανότητα , από την παραπάνω διασταύρωση , να γεννηθεί διαγονιδιακός απόγονος ;
ε) Ποια η πιθανότητα , από την παραπάνω διασταύρωση , να γεννηθεί αξιοποιήσιμος από τη  φαρκοβιομηχανία ,  διαγονιδιακός απόγονος ;

Παρασκευή, 21 Οκτωβρίου 2016

Gene transfer in plants using Ti plasmid

Agrobacterium Mechanism

ΑΣΚΗΣΗ ΜΕ ΤΟ ΠΛΑΣΜΙΔΙΟ Ti



Θέλουμε να κατασκευάσουμε ένα  διαγονιδιακό φυτό ποικιλίας Bt  στο εργαστήριο .Για το σκοπό αυτό χρησιμοποιούμε το πλασμίδιο Ti που το απομoνώσαμε από το βακτήριο Agrobacterium tumefaciens .Στο πλασμίδιο αυτό υπάρχουν οι εξείς περιοχές :
α) η περιοχή ori που είναι υπεύθυνη για την αντιγραφή του πλασμιδίου ,
β) η περιοχή con που είναι υπεύθυνη για τη συζευκτική μεταφορά του πλασμιδίου στο βακτήριο ,
γ) η περιοχή T DNA  που περιέχει γονίδια που δημιουργούν όγκους ,όπως γονίδια που κωδικοποιούν τις φυτοορμόνες Αυξίνη και Κυτοκίνη  αλλά και περιοχές που συμβάλλουν στην ενσωμάτωση  του TDNA στο DNA των φυτικών κυττάρων ,
δ) η περιοχή vir που είναι υπεύθυνη για τη μεταφορά του T DNA μέσα στο φυτικό κύτταρο .
1) Αν διαθέτουμε περιοριστικές ενδονουκλεάσες που μπορούν να δράσουν σε όλες τις παραπάνω περιοχές , ποια περιοχή θα θέλαμε να κόψουν και για ποιον λόγο ;

2)  Στην περιοχή που κόψαμε ενσωματώνουμε το γονίδιο μιας  εντομοτοξίνης  , το οποίο το απομονώνουμε από  ένα βακτήριο με την βοήθεια της περιοριστικής ενδονουκλεάσης Taq I  , που αναγνωρίζει την
TCGA  3΄
AGCT  

αλληλουχία            και την κόβει μεταξύ Τ και C .

Με ποια περιοριστική ενδονουκλεάση θα πρέπει να κόψουμε το πλασμίδιο Τi ; Αιτιολογείστε την απάντησή σας .

3) Γιατί η ποικιλία ονομάζεται Bt ; Να περιγράψετε αναλυτικά τον βιοτεχνολογικό τρόπο δημιουργίας της και να αναφερθείτε και στα ένζυμα που θα πρέπει να χρησιμοποιηθούν .

4) Αν το γονίδιο της εντομοτοξίνης βρίσκεται στο παρακάτω τμήμα DNA , να αποδώσετε το θραύσμα που περιέχει το γονίδιο , μετά τη δράση της Taq I .Ο υποκινητής του γονιδίου , σε ποια μεριά του θραύσματος (αριστερή ή δεξιά) , μέσα στο ανασυνδιασμένο πλασμίδιο Ti θα βρίσκεται ;

CAAGCTCCTTACTCGACATGCCTTACGACAAGTTC TAAGATTCTTTAGCTCTCGACG  
GTTCGAGGAATGAGCTGTACGGAATGCTGTTCAAGATTCTAAGAAATCGAGAGCTGC

5) Με τη χρήση του γενετικού κώδικα να βρεθεί το πεπτίδιο της εντομοτοξίνης  .